View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4891_high_5 (Length: 363)
Name: NF4891_high_5
Description: NF4891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4891_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 113 - 349
Target Start/End: Complemental strand, 28817901 - 28817665
Alignment:
| Q |
113 |
gttgaaacatttagaaatacattttgtggaattatatgatcctttaagcaaatataacattcttgcaagaaactgaagtctaatcatgttacctgaattg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817901 |
gttgaaacatttagaaatacattttgtggaattatatgatcctttaagcaaatataacattcttgcaagaaactgaagtctaatcatgttacctgaattg |
28817802 |
T |
|
| Q |
213 |
atgttttctgctgattgtctagcatgtcatacaaacagttttaaggatgtggtgataaatgtcgttgttcaagtgacacttcttggcactactttgaaat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817801 |
atgttttctgctgattgtctagcatgtcatacaaacagttttaaggatgtgctgataaatgtcattgttcaagtgacacttcttggcactactttgaaat |
28817702 |
T |
|
| Q |
313 |
tcatgtcactctcaccattgtggatcagttggtttct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817701 |
tcatgtcactctcaccattgtggatcagttggtttct |
28817665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 4 - 70
Target Start/End: Complemental strand, 28817995 - 28817929
Alignment:
| Q |
4 |
atgagttacaatgatggaatattatcttcatatctctactggtaagtccaaattatatatgatataa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28817995 |
atgagttacaatgatggaatattatcttcatatctctactggtaagtccaaattatatatgatataa |
28817929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University