View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4892-Insertion-5 (Length: 149)
Name: NF4892-Insertion-5
Description: NF4892
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4892-Insertion-5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 6 - 149
Target Start/End: Complemental strand, 44191331 - 44191188
Alignment:
| Q |
6 |
caaaactcataacatatgagagaggaatagtgcgacattttccacacgaaaaagatagagggatggtaagtacgtagtgagggaaactaatagcagctgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44191331 |
caaaactcataacatatgagagaggaatagtgcgacatttttcacacgaaaaagatagagggatggtaagtacgtagtgagggaaaccaatagcagctgt |
44191232 |
T |
|
| Q |
106 |
tatcatttaatagttatttcattgaatgcttaatctagttgtta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44191231 |
tatcatttaatagttatttcattgaatgcttaatctagttgtta |
44191188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 44202623 - 44202577
Alignment:
| Q |
20 |
tatgagagaggaatagtgcgacattttccacacgaaaaagatagagg |
66 |
Q |
| |
|
||||||||||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
44202623 |
tatgagagaggaataatgcgacatttgtcacgcgaaaaagatagagg |
44202577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University