View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4893_high_9 (Length: 225)
Name: NF4893_high_9
Description: NF4893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4893_high_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 52730979 - 52730777
Alignment:
| Q |
23 |
gttcaggaaggagaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52730979 |
gttcaggaaggagaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacc |
52730880 |
T |
 |
| Q |
123 |
tacaaatcattagttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52730879 |
tacaaatcattagttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattat |
52730780 |
T |
 |
| Q |
223 |
att |
225 |
Q |
| |
|
||| |
|
|
| T |
52730779 |
att |
52730777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University