View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4893_high_9 (Length: 225)

Name: NF4893_high_9
Description: NF4893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4893_high_9
NF4893_high_9
[»] chr3 (1 HSPs)
chr3 (23-225)||(52730777-52730979)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 23 - 225
Target Start/End: Complemental strand, 52730979 - 52730777
Alignment:
23 gttcaggaaggagaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacc 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52730979 gttcaggaaggagaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacc 52730880  T
123 tacaaatcattagttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52730879 tacaaatcattagttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattat 52730780  T
223 att 225  Q
    |||    
52730779 att 52730777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University