View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895-Insertion-10 (Length: 182)
Name: NF4895-Insertion-10
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895-Insertion-10 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 8 - 182
Target Start/End: Original strand, 26776105 - 26776279
Alignment:
| Q |
8 |
agaagattgcggccggtgtgcctgggaaatctttggaacaaattaaacatcactatgaggttttgatagatgatatccacaacattgaatctggttttgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26776105 |
agaagattgcggccggtgtgcctgggaaaactttggaacaaattaaacatcactatgaggttttggtagatgatattcacaacattgaatctggttttgt |
26776204 |
T |
|
| Q |
108 |
gcctccaccagattatgattctttttcaaactcaacaaagtgtactattgtcaaaaagggaattaaggcttccgg |
182 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
26776205 |
gcctctaccagattatgattctttttcaaactcaacaaagtgtactattgttaaaaagggaactaaggcttccgg |
26776279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 8 - 137
Target Start/End: Complemental strand, 26556570 - 26556441
Alignment:
| Q |
8 |
agaagattgcggccggtgtgcctgggaaatctttggaacaaattaaacatcactatgaggttttgatagatgatatccacaacattgaatctggttttgt |
107 |
Q |
| |
|
|||| |||||||| | |||||| |||||| |||| ||| | ||||||| |||||||| ||||||| | ||||||||| || ||||||||||||||||||| |
|
|
| T |
26556570 |
agaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtcactatgtggttttgtttgatgatatcaaccacattgaatctggttttgt |
26556471 |
T |
|
| Q |
108 |
gcctccaccagattatgattctttttcaaa |
137 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
26556470 |
gcctctgccagattatgattctttttcaaa |
26556441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University