View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895-Insertion-11 (Length: 104)
Name: NF4895-Insertion-11
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895-Insertion-11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 8e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 8e-49
Query Start/End: Original strand, 7 - 104
Target Start/End: Complemental strand, 41756243 - 41756146
Alignment:
| Q |
7 |
acatagtctatgtcttgtgttcgattctcgtttcttgcttttcttattgcagctctagcttgtagtagaccagcttcggttctgtctaagatgctgaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41756243 |
acatagtctatgtcttgtgttcgattctcgtttcttgcttttcttattgcagctctagcttgtagtagaccagcttcggttctgtctaagatgctgaa |
41756146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 6e-22
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 41764201 - 41764105
Alignment:
| Q |
7 |
acatagtctatgtcttgtgttcgattctcgtttcttgcttttcttattgcagctctagcttgtagtagaccagcttcggttctgtctaagatgctga |
103 |
Q |
| |
|
||||||||||||||||||||| | || | ||| |||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
41764201 |
acatagtctatgtcttgtgtttgttttccatttactgcttttcttattgcagctctagcttgtagtagatcagcttcgactctgtctaagttgctga |
41764105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University