View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895-Insertion-5 (Length: 590)
Name: NF4895-Insertion-5
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895-Insertion-5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 4e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 8 - 121
Target Start/End: Complemental strand, 33008916 - 33008803
Alignment:
| Q |
8 |
agaatttctttcatgttagactcttgttgattaccttgattaggcattacaccaagatcttccttccaatggaagttaggatggctcacttacccatgat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33008916 |
agaatttctttcatgttagactcttgttgattaccttgattaggcattacaccatgatcttccttccaatggaagttaggatggctcacttacccatgat |
33008817 |
T |
 |
| Q |
108 |
tgtaattgttaata |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33008816 |
tgtaattgttaata |
33008803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 448 - 542
Target Start/End: Complemental strand, 33008793 - 33008699
Alignment:
| Q |
448 |
gaacttggtttaaaatgatgacaagtgattatgatttcctgaatttctcgatatcttgtttggtaacactagtttctaattcaattgaaattccc |
542 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33008793 |
gaacttggtttaaaatgatgacaagtgattatgatttcctgaatttctcgatatcttgtttggtaacactagtttcttattcaattgaaattccc |
33008699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University