View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895_high_13 (Length: 234)
Name: NF4895_high_13
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 73 - 196
Target Start/End: Complemental strand, 25975718 - 25975593
Alignment:
| Q |
73 |
atatcaaaaacaatgcgtataatataatgtaaatagnnnnnnnn--ttgaagtaataatgtacatagaaattatcccctagggatgtctaaaagccaaat |
170 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||| ||||| ||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25975718 |
atatcaaaaacaacgcgtataatataatgtacatagaaaaaaaaaattgaaataatactgttcatagaaattatcccctagggatgtctaaaagccaaat |
25975619 |
T |
|
| Q |
171 |
tttattcaaattcaatagctttttaa |
196 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
25975618 |
tttattcaatttcaatagctttttaa |
25975593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 25975815 - 25975754
Alignment:
| Q |
1 |
atttaatacggcttcaagattaatcgaaagtcatttattataaactaattaacaatgtgtag |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25975815 |
atttaatacggcttcaagattaatcgaaagtcatttattataaactaattaacaatatgtag |
25975754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University