View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895_low_10 (Length: 260)
Name: NF4895_low_10
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 13923762 - 13923521
Alignment:
| Q |
1 |
aattaattccaataagaaatttggtacaatatgaaatccacttgatactctactatcagtctagaattggttggcctagtttggttaatttcaagtagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13923762 |
aattaattccaataagaaatttggtacaatatgaaatccacttgatactctactatcagtgtagaattggttggcctagtttggttaatttcaagtagtt |
13923663 |
T |
 |
| Q |
101 |
gaaaatgatcgatctagacattaatgaatggaagaaaaaccccaacatatttttagtgaacctcttctagttgcaactagctaggaaatttccttcaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13923662 |
gaaaatgatcgatctagacattaatgaatggaagaaaaaccccaacatatttttagtgaacctcttctagttgcaactagctaggaaatttccttcaatc |
13923563 |
T |
 |
| Q |
201 |
taaatag-ccaattgctgtgtagtgtacagccctaacgatcc |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
13923562 |
taaatagcccaattgctgtgtagtgtacagccccaacgatcc |
13923521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University