View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4895_low_9 (Length: 261)
Name: NF4895_low_9
Description: NF4895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4895_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 38968661 - 38968892
Alignment:
| Q |
10 |
attatactataagagaagttaatgtcacaatatgccatactttgctttgatgcaccttgttacccaaaatttatgcagatcttaaccttaataatcatga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38968661 |
attatactataagagaagttaatgtcacaatatgccatactttgctttgatgcaccttgttaccaaaaatttatgcagatcttaaccttaataatcatga |
38968760 |
T |
 |
| Q |
110 |
ttcaataatatgtcccatatttttcactttgaaaatcttctaaatcactcgctaataaaatttgtagttggaaaactcgacaaagataattgttgtcctt |
209 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38968761 |
ttcaagaatatatcccatatttttcactttgaaaatcttctaaatcactcgctaataaaatttgtagttggaaaactcgacaaagataattgttgtcctt |
38968860 |
T |
 |
| Q |
210 |
tgcttttgatagtccaatttggatatgggatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38968861 |
tgcttttgatagtccaatttggatatgggatt |
38968892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University