View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4896-Insertion-6 (Length: 220)
Name: NF4896-Insertion-6
Description: NF4896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4896-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 30247321 - 30247114
Alignment:
| Q |
8 |
gctcttgttccttgaaccttagttcttagttttatcatcagagacttggatgaatgtgatgcaagcaaattctttaattaatcctatgtcaatgctcttg |
107 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30247321 |
gctcctgttccttcaaccttagttcttagttttattatcagagacttggatgcatgtgatgtaagcaaattctttaattaatcctatgtcaatgctcttg |
30247222 |
T |
|
| Q |
108 |
cttcttgggagttacaattattattaatttctattgggtaacataccaagtttcttgtacaaccat--tattccaataaacaagtacaaagtgccagttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||| ||||||| | |||||| |
|
|
| T |
30247221 |
cttcttgggagttacaattattattaatttctattgggtaacataccaaatttcttgtacaaccattatattccactaaacaaatacaaagaggcagttg |
30247122 |
T |
|
| Q |
206 |
aactagta |
213 |
Q |
| |
|
||| |||| |
|
|
| T |
30247121 |
aaccagta |
30247114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 8 - 104
Target Start/End: Complemental strand, 30783569 - 30783473
Alignment:
| Q |
8 |
gctcttgttccttgaaccttagttcttagttttatcatcagagacttggatgaatgtgatgcaagcaaattctttaattaatcctatgtcaatgctc |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783569 |
gctcttgttccttgaaccttagctcttagttttatcatcagagacttggatgcatgtgatgtaagcaaattctttaattaatcctatgtcaatgctc |
30783473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 101 - 161
Target Start/End: Complemental strand, 30783313 - 30783253
Alignment:
| Q |
101 |
gctcttgcttcttgggagttacaattattattaatttctattgggtaacataccaagtttc |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783313 |
gctcttgcttcttgggagttacaattattattaatttctattgggtaacataccaagtttc |
30783253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University