View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4896-Insertion-7 (Length: 104)

Name: NF4896-Insertion-7
Description: NF4896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4896-Insertion-7
NF4896-Insertion-7
[»] chr5 (1 HSPs)
chr5 (8-104)||(2272686-2272782)
[»] chr6 (1 HSPs)
chr6 (38-65)||(5823676-5823703)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 3e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 3e-48
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 2272686 - 2272782
Alignment:
8 ttaaggacagacttaatgttcgtgtccaagacaaagtgaatatatgttgatgttcatatcagtttattaatttgaattgtctagcttttcaattggt 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2272686 ttaaggacagacttaatgttcgtgtccaagacaaagtgaatatatgttgatgttcatatcagtttattaatttgaattgtctagcttttcaattggt 2272782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 38 - 65
Target Start/End: Original strand, 5823676 - 5823703
Alignment:
38 acaaagtgaatatatgttgatgttcata 65  Q
    ||||||||||||||||||||||||||||    
5823676 acaaagtgaatatatgttgatgttcata 5823703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University