View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4896_high_4 (Length: 252)
Name: NF4896_high_4
Description: NF4896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4896_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 141 - 242
Target Start/End: Original strand, 43026176 - 43026277
Alignment:
| Q |
141 |
caaatggtggggcacaatgtgagtaattagtgttgtaagctctaggataagataccagttcaattccctattgataaaaaagtatatggtgtctgatctg |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43026176 |
caaatggtggtgcacaatgtgagtaattagtgttgtatgctctaggataagataccagttcaatttcctattgataaaaaagtatatggtgtctgatctg |
43026275 |
T |
|
| Q |
241 |
tg |
242 |
Q |
| |
|
|| |
|
|
| T |
43026276 |
tg |
43026277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 43026090 - 43026169
Alignment:
| Q |
18 |
ttttccagtcatctcgaggttctttttaacaaatgtt-gacgattgttttgaaacattcatttttataatttataccata |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43026090 |
ttttccagtcatctcgaggttctttttaacaaatgttagacgattgttttgaaacattcatttttataatttataccata |
43026169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University