View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4896_low_3 (Length: 263)
Name: NF4896_low_3
Description: NF4896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4896_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 53 - 248
Target Start/End: Complemental strand, 50591017 - 50590829
Alignment:
| Q |
53 |
taaaatgctgtaggaaatagtgataaacagaaggcaaacaaacaagtagttaattaaggaatgaacaaatgaatgaaagtaaataaatattccttttagc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50591017 |
taaaatgctgtaggaaatagtgataaacagaaggcaaacaaacaagtagttaatta---------caaatgaatgaaagtaaataaatattccttttagc |
50590927 |
T |
 |
| Q |
153 |
ttctatgaggcttctttccattccaaccaatggccttaaccattggaaattcataaggcgttaacattgcaaaagtg--aataatcatattgatggca |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50590926 |
ttctatgaggcttctttccattccaaccaatggccttaaccattggaaattcataaggcgttaacattgcaaaagtgaaaataatcatattgatggca |
50590829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 50591109 - 50591073
Alignment:
| Q |
19 |
agcacagcaatgagctgattaccgataacatacctaa |
55 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
50591109 |
agcatagcaatgagctgattaccaataacatacctaa |
50591073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University