View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4898_low_6 (Length: 315)
Name: NF4898_low_6
Description: NF4898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4898_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 45721431 - 45721132
Alignment:
| Q |
1 |
gtaagcgctgaaatgcaataagcatgtaaatctgtaatcacaaaagaatattcattttagtacaaacacgaattgatgtcaaacctcaacaatacttact |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45721431 |
gtaagcgttgaaatgcaataagcatgtaaatctgtaatcacaaaagaatattcattttagtacaaacacgaattgatgtcaaacctcaacaatacttact |
45721332 |
T |
 |
| Q |
101 |
tttggggagttttggtgcaactttctgggatgcctgggagaggtgttgggtttgtatttttcatgtttgttagtgtagtgtaccagtcggtgttacttac |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45721331 |
ttgggggagttttggtgcaactttctgggatgcctgggagaggtgttgggtttgtatttttcatgtttgttagtgtagtgtaccagtcggtgttacttac |
45721232 |
T |
 |
| Q |
201 |
gatggaaggtttcatctcgatctcttcggtgtcttcgagaaacttgtaacctttagttcatttaagcttgttgttaccggagtatttgtacccttcatct |
300 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45721231 |
gatggaaggtttcatcttgatctcttcagtgtctttgagaaacttgtaacctttagttcatttaagcttgttgttaccggagtatttgtacccttcatct |
45721132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University