View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4898_low_7 (Length: 270)
Name: NF4898_low_7
Description: NF4898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4898_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 49490769 - 49490551
Alignment:
| Q |
18 |
cggacatctcatctaccatacaatgaagacttttcataatttctcttggtcaatatttaagcttaggtaaatgttatccaaagatggtggctatatttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49490769 |
cggacatctcatctaccatacaatgaagacttttcataatttctcttggtcaatatttaagcttaggtaaatgttatccaaagatggtggctatatttaa |
49490670 |
T |
|
| Q |
118 |
ttataaacgagcaaataatcatcagcaataccatcatccgaatatgcaatattattttgagtagactcactctaacattgaacatatttcgaaattattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
49490669 |
ttataaacgagcaaataatcatcagcaataccatcatccgaatatgcaatattattttgagtagactcactctaacattgaatagatttcgaaattattc |
49490570 |
T |
|
| Q |
218 |
tttccaaagtggcacgaat |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
49490569 |
tttccaaagtggcacgaat |
49490551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University