View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4899_high_13 (Length: 267)
Name: NF4899_high_13
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4899_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 103 - 248
Target Start/End: Complemental strand, 21007469 - 21007324
Alignment:
| Q |
103 |
ctttgggctgatctcactcatcagggttgtttattggtgattttaatgcagtgttgggtgcacatcaaaagtgtggtcgtcgccctccgccatcagtttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21007469 |
ctttgggctgatctcactcatcagggttgtttattggtgattttaatgcagtgttgggtgcacatcaaaagtgtggtcgtcgccctccgccatcactttc |
21007370 |
T |
 |
| Q |
203 |
ttgtttggactttttgcggtggactaatgctaacttggctcttcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21007369 |
ttgtttggactttttgcggtggactaatgctaacttggctcttcat |
21007324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 14641106 - 14641163
Alignment:
| Q |
127 |
ggttgtttattggtgattttaatgcagtgttgggtgcacatcaaaagtgtggtcgtcg |
184 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
14641106 |
ggttatttgttggggattttaatgcagtgttgggtgcgcatgagaagtgtggtcgtcg |
14641163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 19746764 - 19746827
Alignment:
| Q |
127 |
ggttgtttattggtgattttaatgcagtgttgggtgcacatcaaaagtgtggtcgtcgccctcc |
190 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| ||| ||||| ||||| |||| ||||| |
|
|
| T |
19746764 |
ggttatttcttggtgattttaatgcagtgttgggtgctcatgaaaagcgtggttgtcggcctcc |
19746827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University