View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4899_high_24 (Length: 232)
Name: NF4899_high_24
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4899_high_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 213
Target Start/End: Original strand, 2732409 - 2732609
Alignment:
| Q |
13 |
cagagagtaaaatccccatatcctattggcaagtctctatataaaatatggaaaggaatattaggacgctagaaccatcattttacaacaattattgatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2732409 |
cagagagtaaaatccccatatcctattggcaagtctctatataaaatatggaaaggaatagtaggacgctagaaccatcattttacaacaattattgatc |
2732508 |
T |
 |
| Q |
113 |
aaatacctttaatgtttcacttaccctagagcagatataatccattccctgagtgttcgagcattcaacatggtttcagcagtcgtaaaagtcttcgaca |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2732509 |
aaataactttaatgtttcacttaccctagagcggatataatccattccctgagtgttcgagcattcaacatggtttcagcagtcgtaaaagtcttcgaca |
2732608 |
T |
 |
| Q |
213 |
c |
213 |
Q |
| |
|
| |
|
|
| T |
2732609 |
c |
2732609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University