View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4899_low_20 (Length: 243)

Name: NF4899_low_20
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4899_low_20
NF4899_low_20
[»] chr1 (2 HSPs)
chr1 (18-141)||(27028300-27028423)
chr1 (208-243)||(27028198-27028233)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 27028423 - 27028300
Alignment:
18 gatagttgttagttgatttgattgaagtaaaatttattggcttttcgttaggttgtttttggaccaagttttttctagttagttgatttgatatgctagt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27028423 gatagttgttagttgatttgattgaagtaaaatttattggcttttcgttaggttgtttttggaccaagttttttctagttagttgatttgatatgctagt 27028324  T
118 taatttttggaggaaagaaaatac 141  Q
    ||||||||||||||||||||||||    
27028323 taatttttggaggaaagaaaatac 27028300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 243
Target Start/End: Complemental strand, 27028233 - 27028198
Alignment:
208 taagactaagttatgttactgatccgtatatgtaat 243  Q
    ||||||||||||||||||||||||||||||||||||    
27028233 taagactaagttatgttactgatccgtatatgtaat 27028198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University