View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4899_low_20 (Length: 243)
Name: NF4899_low_20
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4899_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 18 - 141
Target Start/End: Complemental strand, 27028423 - 27028300
Alignment:
| Q |
18 |
gatagttgttagttgatttgattgaagtaaaatttattggcttttcgttaggttgtttttggaccaagttttttctagttagttgatttgatatgctagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27028423 |
gatagttgttagttgatttgattgaagtaaaatttattggcttttcgttaggttgtttttggaccaagttttttctagttagttgatttgatatgctagt |
27028324 |
T |
 |
| Q |
118 |
taatttttggaggaaagaaaatac |
141 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
27028323 |
taatttttggaggaaagaaaatac |
27028300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 208 - 243
Target Start/End: Complemental strand, 27028233 - 27028198
Alignment:
| Q |
208 |
taagactaagttatgttactgatccgtatatgtaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27028233 |
taagactaagttatgttactgatccgtatatgtaat |
27028198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University