View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4899_low_24 (Length: 234)
Name: NF4899_low_24
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4899_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 8828993 - 8829199
Alignment:
| Q |
12 |
gattattctagaaaagctaaatatgtgagttttgcactcagaatcatggttatataaatgcagatgggatcaagattcnnnnnnncagtgatatctgaga |
111 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8828993 |
gattactctagaaaagctaaataggtgagttttgcactcagaatcatggttatataaatgcagatgggatcaagattcaaaaaaacagtgatatctgaga |
8829092 |
T |
|
| Q |
112 |
gtgtaaggaaatcattatctaaatggcagagaagagtgaaggagaaacaaagttcctcttatgaactccttaatacatcaacaacaacatcattggagtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8829093 |
gtgtaaggaaatcattatctaaatggcagagaagagtgaaggagaaacaaagttcctcttatgaactccttaatacatcaacaacaacatcattggagtc |
8829192 |
T |
|
| Q |
212 |
tttactg |
218 |
Q |
| |
|
||||||| |
|
|
| T |
8829193 |
tttactg |
8829199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University