View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4899_low_6 (Length: 396)
Name: NF4899_low_6
Description: NF4899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4899_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 347
Target Start/End: Complemental strand, 20427368 - 20427047
Alignment:
| Q |
18 |
accttacagattgaagtctcttgcaaagaaaagaaatgagaaactgaatccccgtttctatggtccttatcagattatcaagcaaataggtcaagttgct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20427368 |
accttacagattgaagtctcttgcaaagaaaagaaatgagaaactgaatcaccgtttctatggtccttatcagattatcaagcaaataggttaagttgct |
20427269 |
T |
|
| Q |
118 |
tttgaattcgctctacctccagaaagcaaaatacacccagttttccatgcatctttactgaagaaagctatttctccctcaacaaatccacaaccacttc |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20427268 |
tttgaattcgctgtacctccagaaagcaaaatacacccagttttccatgcatctttactgaagaaagctatttctccctcaacaaatccacaaccacttc |
20427169 |
T |
|
| Q |
218 |
cgccaatgctctctgaagacatggaattacaagttgtccctgctgatgtcaaagctgtacgcaacactact----gatggtgttgctgaggtcctcattc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20427168 |
cgccaatgctctctgaagacatggaattacaagttgtccct------------gctgtacgcaacactactgatggatggtgttgctgaggtcctcattc |
20427081 |
T |
|
| Q |
314 |
aatggaaagaccttcccgaatttgaagctacttg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20427080 |
aatggaaagaccttcccgaatttgaagctacttg |
20427047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University