View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4900-Insertion-3 (Length: 426)
Name: NF4900-Insertion-3
Description: NF4900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4900-Insertion-3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 8e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 6 - 131
Target Start/End: Original strand, 10714830 - 10714955
Alignment:
| Q |
6 |
cacttggatcacggtggtgtacgcagatagacacctttttgtgttggaagtcagagatttccatggacaagaattggtgtatccacaattcactcctcct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10714830 |
cacttggatcacggtggtgtacgcagatagacacctttttgtgttggaagtcagagatttccatggacaagaattggtgtatccacaattcactcctcct |
10714929 |
T |
 |
| Q |
106 |
caaagattgctgctggagaatcatag |
131 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10714930 |
caaagattgctgctggagaatcatag |
10714955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University