View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4900-Insertion-8 (Length: 253)
Name: NF4900-Insertion-8
Description: NF4900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4900-Insertion-8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 8 - 124
Target Start/End: Complemental strand, 34533121 - 34533005
Alignment:
| Q |
8 |
atgaaaacctaaaacagcgaaggattattacattagcaaacacgcatgtggtttgaacactgtaaatattcatccaaattcttaatttaacgtaggagtc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34533121 |
atgaaaacctaaaacagcgaaggattattacattagcaaacacacatgtggtttgaacactgtaaatattcatccaaattcttaatttaacgtaggagtc |
34533022 |
T |
 |
| Q |
108 |
tattcacttgtatatat |
124 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34533021 |
tattcacttgtatatat |
34533005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University