View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4901_low_4 (Length: 253)
Name: NF4901_low_4
Description: NF4901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4901_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 6715737 - 6715620
Alignment:
| Q |
1 |
gaaatgttttttgttacttataagcttatgatttaactaaatcagttgacttagtaaagaaaatgcaatttatgagtcaataaaattgcaaattcaaatt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6715737 |
gaaatgatttttgttacttataagcttatgatttaattaaatcagttgacttagtaaagaaaatgcaatttatgagtcaataaaattgcaaattcaaatt |
6715638 |
T |
 |
| Q |
101 |
aagcttttctttggtcac |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6715637 |
aagcttttctttggtcac |
6715620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University