View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4901_low_4 (Length: 253)

Name: NF4901_low_4
Description: NF4901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4901_low_4
NF4901_low_4
[»] chr6 (1 HSPs)
chr6 (1-118)||(6715620-6715737)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 6715737 - 6715620
Alignment:
1 gaaatgttttttgttacttataagcttatgatttaactaaatcagttgacttagtaaagaaaatgcaatttatgagtcaataaaattgcaaattcaaatt 100  Q
    |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6715737 gaaatgatttttgttacttataagcttatgatttaattaaatcagttgacttagtaaagaaaatgcaatttatgagtcaataaaattgcaaattcaaatt 6715638  T
101 aagcttttctttggtcac 118  Q
    ||||||||||||||||||    
6715637 aagcttttctttggtcac 6715620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University