View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4901_low_5 (Length: 233)

Name: NF4901_low_5
Description: NF4901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4901_low_5
NF4901_low_5
[»] chr7 (1 HSPs)
chr7 (7-156)||(35145230-35145379)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 7 - 156
Target Start/End: Complemental strand, 35145379 - 35145230
Alignment:
7 aattcatggttttaattgcagactggtggtatgctgttattggtcacctagattcttgtaatgaaaatgagaattattgcttctgtcaaaactctggtga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35145379 aattcatggttttaattgcagactggtggtatgctgttattggtcacctagattcttgtaatgaaaatgagaattattgcttctgtcaaaactctggtga 35145280  T
107 gaatttttgatcacctagattcaatttttgtatatgcatcagatgcactg 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
35145279 gaatttttgatcacctagattcaatttttgtatatgcatcagatgcactg 35145230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University