View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4902_high_12 (Length: 249)

Name: NF4902_high_12
Description: NF4902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4902_high_12
NF4902_high_12
[»] chr5 (2 HSPs)
chr5 (10-193)||(15923463-15923646)
chr5 (191-231)||(15923247-15923287)


Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 15923646 - 15923463
Alignment:
10 ataatactcaagactagtagaaagtttgtctacttttttcttctattataactcaatttaagtttcatggacccccaataaaaccatgtcgattgctctt 109  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15923646 ataatactcaagactagtagaaagtttgtctactcttttcttctattataactcaatttaagtttcatggacccccaataaaaccatgtcgattgctctt 15923547  T
110 caggcttctagaaagtgtcgaacaataaataattactgttttaaattacttttttaatcggtttaatcaatttaaaaagtgtca 193  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
15923546 caggcttctagaaagtgtcgaacgataaataattactgttttaaattacttatttaatcggtttaatcaatttaaaaagtgtca 15923463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 231
Target Start/End: Complemental strand, 15923287 - 15923247
Alignment:
191 tcatcttacaaattgattttgtaaaagttagattatgtcta 231  Q
    |||||||||||||||||||||||||||||||||||||||||    
15923287 tcatcttacaaattgattttgtaaaagttagattatgtcta 15923247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University