View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4902_high_14 (Length: 239)
Name: NF4902_high_14
Description: NF4902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4902_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 28 - 239
Target Start/End: Complemental strand, 2166172 - 2165959
Alignment:
| Q |
28 |
tctgtgtaatgtgacccttgtcatgaagacaatctccttata-ctagagagatatcatacattattgataacatagagtatttgtcttgagctgtatgat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2166172 |
tctgtgtaatgtgacccttgtcatgaagacaatctccttataactagagagatatcatacattattgataacatagagtatttgtcttgagctgtatgat |
2166073 |
T |
 |
| Q |
127 |
gctttctcttttcagcaataaaagaaacatatttttcttttcaacattgtcactatagttctttgctatatcaaaataaattcacttc-aagtgttattt |
225 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2166072 |
gatttctcttttcagcaataaaagaaacatatttttcttttcaacattgtcactatagttcttggctatatcaaaataaattcacttcaaagtgttattt |
2165973 |
T |
 |
| Q |
226 |
tatgtatgtaattt |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2165972 |
tatgtatgtaattt |
2165959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University