View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4902_low_12 (Length: 249)
Name: NF4902_low_12
Description: NF4902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4902_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 10 - 193
Target Start/End: Complemental strand, 15923646 - 15923463
Alignment:
| Q |
10 |
ataatactcaagactagtagaaagtttgtctacttttttcttctattataactcaatttaagtttcatggacccccaataaaaccatgtcgattgctctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15923646 |
ataatactcaagactagtagaaagtttgtctactcttttcttctattataactcaatttaagtttcatggacccccaataaaaccatgtcgattgctctt |
15923547 |
T |
 |
| Q |
110 |
caggcttctagaaagtgtcgaacaataaataattactgttttaaattacttttttaatcggtttaatcaatttaaaaagtgtca |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15923546 |
caggcttctagaaagtgtcgaacgataaataattactgttttaaattacttatttaatcggtttaatcaatttaaaaagtgtca |
15923463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 191 - 231
Target Start/End: Complemental strand, 15923287 - 15923247
Alignment:
| Q |
191 |
tcatcttacaaattgattttgtaaaagttagattatgtcta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15923287 |
tcatcttacaaattgattttgtaaaagttagattatgtcta |
15923247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University