View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4902_low_7 (Length: 353)
Name: NF4902_low_7
Description: NF4902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4902_low_7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 20 - 353
Target Start/End: Original strand, 40544686 - 40545019
Alignment:
| Q |
20 |
ccgatggctatctattgggatttctaataatgggaatgttgtttctcatcttttcattattgatctttatcttgtctttgcttatataccgacagggtta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40544686 |
ccgatggctatctattgggatttctaataatgggaatgttgtttctcatcttttcattattgatcattatcttgtctttgcttatataccgacagggtta |
40544785 |
T |
 |
| Q |
120 |
ccaatccaaaattttcctatatgattgatatgaataacccaaggctagctggttgcgaagttgggattttaagtagatcaaggagaatgattttggctaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40544786 |
ccaatccaaaattttcctatatgattgatatgaacaacccaaggctagctggttgcgaagttgggattttaagtagatcaaggggaatgattttggctaa |
40544885 |
T |
 |
| Q |
220 |
gtttgtttttagcccatcattgtggattggctcctagcatgggttttgacttttgatgatgtttttaattagattaattagatgttatttataccttttg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40544886 |
gtttgtttttagcccatcattgtggattggctcctagtatgggttttgacttttgatgatgtttttaattagattaattagatgttatttataccttttg |
40544985 |
T |
 |
| Q |
320 |
tttgtgattctttagctttgttgtgaaagcacct |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40544986 |
tttgtgattctttagctttgttgtgaaagcacct |
40545019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University