View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903-Insertion-5 (Length: 189)
Name: NF4903-Insertion-5
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 6e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 6e-42
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 47365650 - 47365736
Alignment:
| Q |
7 |
acatagtacaattaaggacagacaaactgaaggtgaacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365650 |
acatagtacaattaaggacagacaaactgaaggtgaacttaggaacagatactagaattttatatgcaaatttcacatatttaatac |
47365736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 150 - 189
Target Start/End: Original strand, 47365793 - 47365832
Alignment:
| Q |
150 |
ctttagtggattagattgacaaactgaagtcaccttacta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365793 |
ctttagtggattagattgacaaactgaagtcaccttacta |
47365832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University