View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903-Insertion-6 (Length: 182)
Name: NF4903-Insertion-6
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903-Insertion-6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 182
Target Start/End: Original strand, 8954757 - 8954931
Alignment:
| Q |
8 |
ttactctcacaaagcaagttcaacggagaaaggaagccatgaagtaccgaaaaacaattctacacgccatttgcaccgccgcaggagtagggggagtaaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
8954757 |
ttactctcacaaagcaagttcaacggagaaaggaagccatgaagtaccgaaaaacaattctacacaccatttgcaccgccgcaggagtaggggaagtaaa |
8954856 |
T |
|
| Q |
108 |
ggtagtttcacatcagagtttggaagcgaaaaaagccacattgatcattctgtcatcaacaaaacttcacaatca |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8954857 |
ggtagtttcacatcagagtttggaagcgaaaaaagccacattgatcattctgtcatcaacaaaacttcacaatca |
8954931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University