View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903-Insertion-7 (Length: 85)
Name: NF4903-Insertion-7
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903-Insertion-7 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 6e-37; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 6e-37
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 1949073 - 1949150
Alignment:
| Q |
8 |
tattgaagatgttaacaagttttataatagtagaatgaaggtgaaaatgttgaaatttatgaagtcttatgtgtttgg |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1949073 |
tattgaagatgttaacaagttttataatagtagaatgaaggtgaaaatgttgaaatttatgaagtcttatgtgtttgg |
1949150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 1977333 - 1977256
Alignment:
| Q |
8 |
tattgaagatgttaacaagttttataatagtagaatgaaggtgaaaatgttgaaatttatgaagtcttatgtgtttgg |
85 |
Q |
| |
|
||||||||||||||||||| |||||||| || ||||||| | || || | ||||||||||||||||||||||||||| |
|
|
| T |
1977333 |
tattgaagatgttaacaagagttataataatacaatgaagatcaagatttggaaatttatgaagtcttatgtgtttgg |
1977256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 1984254 - 1984177
Alignment:
| Q |
8 |
tattgaagatgttaacaagttttataatagtagaatgaaggtgaaaatgttgaaatttatgaagtcttatgtgtttgg |
85 |
Q |
| |
|
|||||||||||| ||| || |||||||| || ||||||| | || || | ||||||||||||||||||||||||||| |
|
|
| T |
1984254 |
tattgaagatgtaaaccagagttataataatacaatgaagatcaagatttggaaatttatgaagtcttatgtgtttgg |
1984177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University