View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903_high_10 (Length: 205)
Name: NF4903_high_10
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 85 - 185
Target Start/End: Complemental strand, 39401882 - 39401786
Alignment:
| Q |
85 |
atagtcaatcatattttaccttgcaaataaacttgtatatagatagatatattctaattatgctaaatgcgtacacgtaaggtgtgtttgtttatttaag |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
39401882 |
atagtcaatcatattttaccttgcaaataaacttgtatatagata----tattctaattatgctaaatgcgtacacgcaaggtgtgtttatttatttaag |
39401787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 39402000 - 39401931
Alignment:
| Q |
19 |
gcaaacttgcctgaaagttacgctaccagaatctcatatcgcccgaaagagaattataccatccacatag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39402000 |
gcaaacttgcctgaaagttacgctaccagaatctcatatcgcccgaaagagaattataccatccacatag |
39401931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University