View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903_high_6 (Length: 281)
Name: NF4903_high_6
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 6383585 - 6383735
Alignment:
| Q |
12 |
ataggggattcgagtgtggatgaaaccatggattatcttcttcaaatatttcaattccttgaaaatggaagttgcaagttagtcggaagtgggacaaaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6383585 |
ataggggattcgagtgtggatgaaaccatggattatcttcttcaaatatttcaattccttgaaaatggaagttacaagttagtcggaagtgggacaaaat |
6383684 |
T |
|
| Q |
112 |
gaagatctgaacaccttgtcgaaaaggtatgttatttccttggttgaaaat |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6383685 |
gaagatctgaacaccttgtcgaaaaggtatgttatttccttggttgaaaat |
6383735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 161 - 266
Target Start/End: Original strand, 6383805 - 6383910
Alignment:
| Q |
161 |
atcatatgatgtttttcagtatgtaatcaagtctttttcttgtcgtttagggagtttctagtagttttatagtgagttactcatggtttgagaaagtgta |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6383805 |
atcatatgatgtttttcagtatgtaatcaagtctttttcttgtcgtttaaggagtttctagtagttttatagtgagttactcatggtttgagaaagtgta |
6383904 |
T |
|
| Q |
261 |
acattt |
266 |
Q |
| |
|
|||||| |
|
|
| T |
6383905 |
acattt |
6383910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University