View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903_low_10 (Length: 250)
Name: NF4903_low_10
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 21 - 104
Target Start/End: Original strand, 22714297 - 22714381
Alignment:
| Q |
21 |
ccgacagccacaactttcaaccactattattaaaaacttaaactcatcttagaatcgagattggaatat-aaaaccgaaatcaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| || | ||||| | ||||||||||||||| |
|
|
| T |
22714297 |
ccgacagccacaactttcaaccactattattaaaaacttagactcatcttagaattgaaaatggaaactaaaaaccgaaatcaga |
22714381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 172 - 234
Target Start/End: Original strand, 22714390 - 22714452
Alignment:
| Q |
172 |
caataaagtaccggattgatacctaaatcgataagaacgtgtatcaaattaaaactatactta |
234 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22714390 |
caataaagtactcgattgagacctaaatcaataagaacgtgtatcaaattaaaactatactta |
22714452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University