View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4903_low_7 (Length: 283)
Name: NF4903_low_7
Description: NF4903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4903_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 25565485 - 25565203
Alignment:
| Q |
1 |
aaggacttctattataaggttcttcacaaaccagtgctagtgcaatagagatcatcacaagactcgttctat----------tggttcaaattttgttgt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25565485 |
aaggacttctattataaggttcttcacaaactggtgctagtgcaatagagatcatcacaagactcgttctatgctgtcattttggttcaaattttgttgt |
25565386 |
T |
 |
| Q |
91 |
aaccaccttttcaaaaaatgttttgttgtaaccaaaaatcccctgacagaagctctgttcagttccatgaaatttaagaaataatatacttgtgcagtgt |
190 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25565385 |
aatcaccttttcaaaaaaaaaattgttgtaaccaaaaatcccctgacagaagctctgttcagttgcatgaaatttaagaactaatatacttgtgcagtgt |
25565286 |
T |
 |
| Q |
191 |
ctaattctgtcaagataaccattaatatcgatagttaatgatgatgacttacactgagtaatttatggatgaaggtgcctatg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25565285 |
ctaattctgtcaagataaccattaatatcgatagttaatgataatgacttacactgagtaatttatacatgaaggtacctatg |
25565203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University