View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4904-Insertion-10 (Length: 292)
Name: NF4904-Insertion-10
Description: NF4904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4904-Insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 7 - 281
Target Start/End: Original strand, 52484256 - 52484507
Alignment:
| Q |
7 |
acctatgacaaggtttacaatgatgaaaatagaagaaggtgtgaaccatgttgctatgaaagttgttgggtctgccatcgttgttaatttcttaatttgg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52484256 |
acctatgacaaggtttacaatgatgaaaatagaagaaggtgtgaaccatgttgctatgaaagttgttgggtctgccatcgttgttaatttcttaatttgg |
52484355 |
T |
|
| Q |
107 |
agggtttttgcgttgagatcgagcttcaacactgactgaagagtgaagacaatgtagggtgggggtgtaaatagagaaaggaaaatcaccatttacgtct |
206 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52484356 |
agggtttttgcgttga----gaccttcaac----actgaagagtgaa---------------gggtgtaaatagagaaaggaaaatcaccatttacgtc- |
52484431 |
T |
|
| Q |
207 |
tagtcatgtagtcagaagaaaggag-aaaaaagttgataaataaataaatatcatgggggtggggaacttgtttct |
281 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52484432 |
tagtcatgtagtcagaagaaaggagaaaaaaagttgataaataaataaatatcatgggggtggggaacttgtttct |
52484507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University