View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4905-Insertion-1 (Length: 433)
Name: NF4905-Insertion-1
Description: NF4905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4905-Insertion-1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 10311909 - 10311999
Alignment:
| Q |
8 |
caatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccaccttcttcctcatatctct |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10311909 |
caatgatgacaaacatggacctatgccttgttttaacgccattctcaatgagagttctgattcgctcatccaccttcttcctcatatctct |
10311999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 13 - 92
Target Start/End: Original strand, 38436254 - 38436333
Alignment:
| Q |
13 |
atgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccaccttcttcctcat |
92 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||| || ||||||||||| || |||||||||||||||||||| |
|
|
| T |
38436254 |
atgacaaacatggatcgatgccttgatttgacgccattttcgataagagttctgatacgttcatccaccttcttcctcat |
38436333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University