View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4905-Insertion-2 (Length: 296)
Name: NF4905-Insertion-2
Description: NF4905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4905-Insertion-2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 8 - 296
Target Start/End: Complemental strand, 4544539 - 4544251
Alignment:
| Q |
8 |
gtttcctccatggtttcaggaccgccagaccattcaacctgtaatttggtttgtatagtgtccaggacaagattaacaaaggtaacatatctnnnnnnnt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4544539 |
gtttcctccatggtttcaggaccgccagaccattcaacctgtaatttggtttgtatagtgtccaggacaagattaacaaaggtaacatatctaaaaaaat |
4544440 |
T |
 |
| Q |
108 |
aatttgatccagtggttggtcaatgaaaacagtgaaagtaccgatttattattcagtattctagtacatcaataactgaatttttatagtaataaactac |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4544439 |
aatttgatccagtggttggtcattgaaaacagtgaaagtaccgatttattattcagtattctagtacatcagtaactgaatttttatagtaataaactac |
4544340 |
T |
 |
| Q |
208 |
ttgtctgttatttacttcccttttctagttcatagtgactgcaatgccctcacaaagtagcaagattcactcacttcacccctctttta |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4544339 |
ttgtctgttatttacttcccttttctagttcatagtgactgcaatgccctcacaaagtagcaagattcactcacttcacccctctttta |
4544251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University