View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4905_high_21 (Length: 239)
Name: NF4905_high_21
Description: NF4905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4905_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 38486072 - 38485855
Alignment:
| Q |
1 |
tgtcacaagcaatttttaaccatttttattctttggtgaactgtatttttaactttatttcaagcaacttccggttaagattggaagaaca-ggagcagc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||| |
|
|
| T |
38486072 |
tgtcacaagcaatttttaaccatttttattctttggtgaactgtatttttaactttatttcaaacaacttccggttaagattggaagaaaatggagcagc |
38485973 |
T |
 |
| Q |
100 |
aagttttgattagttttatcggctacctcctcttaaccagctaacctcctgtacaaggttagtttttgagagttcagaaacatggttaatactacatact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38485972 |
aagttttgattagttttatcggctacctcctcttaaccagctaacctcctgtacaaggttagtttttgagagttcagaaacatggttaatactacatact |
38485873 |
T |
 |
| Q |
200 |
actatggtaaaagaattc |
217 |
Q |
| |
|
| |||||||||| ||||| |
|
|
| T |
38485872 |
attatggtaaaaaaattc |
38485855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University