View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4905_low_14 (Length: 285)
Name: NF4905_low_14
Description: NF4905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4905_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 39496124 - 39496375
Alignment:
| Q |
13 |
aatataaattgaagaaaagaaagtatcaatgcaatcctaatttgaagtcgtaaatataaacacagttagaaatgttgtttggacacaaatttatgtcttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
39496124 |
aatataaattgaagaaaagaaagtatcaatgcattcctaatttgaagtcgtaaatataaacacaattagaaatgttgtttggacacaaatt-atgtcttg |
39496222 |
T |
|
| Q |
113 |
aaatttattacgagtctgtttaaaccgcatgatagagatagattattcatgttgtaccgcaagtataactcatataacaaaaaactatagaaatatttga |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39496223 |
aaatttattacgagt-tgtttaaaccgcatgatagagatagatgattcatgttgtaccgcaagtataactcatataacaaaaaactatagaaatatttga |
39496321 |
T |
|
| Q |
213 |
catgctgcgacacatattaaaatccactatttcctactttgttaacgtgttacg |
266 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
39496322 |
catgctgcgacacataataaaatccactattttctactttgttatcgtgttacg |
39496375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University