View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4906-Insertion-3 (Length: 76)
Name: NF4906-Insertion-3
Description: NF4906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4906-Insertion-3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 29600054 - 29600098
Alignment:
| Q |
23 |
atggatcacttatgaatgtgatatactaaagaactcgccttgagt |
67 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29600054 |
atggaacacttatgaaggtgatatactaaagaactcgccttgagt |
29600098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University