View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4907_high_11 (Length: 231)
Name: NF4907_high_11
Description: NF4907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4907_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 6036524 - 6036719
Alignment:
| Q |
1 |
attaccaatcctatttggactcgatttaaattataattagaaatttttcattcacattcaaacaaatgttccaaagcggggtagctcatgatatagacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6036524 |
attaccaatcctatttggactcgatttaaattataattagaaatttttcattcacattcaaacaaatgttccaaagcggggtagctcatgatatagacta |
6036623 |
T |
|
| Q |
101 |
tctttggatgatgtcgccatcagatggaacatcttgtttagctgctgggacacgaaaagttagataattcagtttcaagaaaaggtcactgattgc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6036624 |
tctttggatgatgtcgccatcagatggaacatcttgtttagctgctgggacacgaaaagttggataattcagtttcaagaaaaggtcactgattgc |
6036719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 104 - 196
Target Start/End: Original strand, 31474746 - 31474839
Alignment:
| Q |
104 |
ttggatgatgtcg-ccatcagatggaacatcttgtttagctgctgggacacgaaaagttagataattcagtttcaagaaaaggtcactgattgc |
196 |
Q |
| |
|
||||||||||||| |||||||| || || ||| || |||||||||||||| ||||| |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
31474746 |
ttggatgatgtcgtccatcagaccgagcaactttctttgctgctgggacacggaaagtcagataatttagtttcaagaaaaggtccctgattgc |
31474839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 141 - 196
Target Start/End: Original strand, 40842344 - 40842399
Alignment:
| Q |
141 |
gctgctgggacacgaaaagttagataattcagtttcaagaaaaggtcactgattgc |
196 |
Q |
| |
|
|||||||||||||| || || |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
40842344 |
gctgctgggacacggaaggtcagataatttagtttcaagaaaaggtccctgattgc |
40842399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University