View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4907_low_10 (Length: 242)
Name: NF4907_low_10
Description: NF4907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4907_low_10 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 11079356 - 11079592
Alignment:
| Q |
6 |
agattattctgatgaagggaaggatccatcaagtccaagttaccaggttttgcttcagtcagctaaatcattaagggaaagtgatgggattatcgtaaac |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11079356 |
agattatcctgatgaagggaaggatccatcaagtccaagttaccaggttttgcttcagtcagctaaatcattaagggaaagtgatgggattatcgtaaac |
11079455 |
T |
 |
| Q |
106 |
actttcgacgctattgaaaagaaagctattaaagctttaagaaatggattgtgtgttcctgatggaaccactccgatgcttttttgcatcggacctgtag |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
11079456 |
actttcgatgctattgaaaagaaagctattaaagctttaagaaatggattgtgtgttcctgatggaaccactccgttgcttttttgcatcggacccgtag |
11079555 |
T |
 |
| Q |
206 |
tgtcaacctcgtgtgaagaagataaaagtgggtgttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11079556 |
tgtcaacctcgtgtgaagaagataaaagtgggtgttt |
11079592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 11002288 - 11002348
Alignment:
| Q |
79 |
agggaaagtgatgggattatcgtaaacactttcgacgctattgaaaagaaagctattaaag |
139 |
Q |
| |
|
|||||| ||| ||||||||| || |||||||| || ||||||||| | ||||||||||||| |
|
|
| T |
11002288 |
agggaatgtgctgggattattgtgaacacttttgatgctattgaagaaaaagctattaaag |
11002348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University