View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4907_low_7 (Length: 294)
Name: NF4907_low_7
Description: NF4907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4907_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 9 - 277
Target Start/End: Original strand, 34768942 - 34769218
Alignment:
| Q |
9 |
gagaagaaggtggtggttg---ttgttgttgttgcggtggagggattgtgggtggattagggttgtttcgtatgtcgaaagcgatggcgagatcaggtgt |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34768942 |
gagaagaaggtggtggttgttgttgttgttgttgcggtggtgggattgtgggtggattagggttgtttcgtatgtcgaaagcgatggcgagatcaggtgt |
34769041 |
T |
 |
| Q |
106 |
gattagggtttgtgataaaggcatgagttcttctggtggtggaagttgttcttcccatcttgaaaaccaatttgaatcatcttctctca--------ttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34769042 |
gattagggtttgtgataaaggcatgagttcttctggtggtggaagttgttcttcccatcttgaaaaccaatttgaatcatcttctctcattttttttttt |
34769141 |
T |
 |
| Q |
198 |
tttgttgaattgaggaggtggtgggtgtgttagtaatttagtagtagtaatggagattgggattttgatgagaagagaga |
277 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34769142 |
tttgttgaattgagaaggaggtgggtgtgttagtaatt---tagtagtaatggagattgggattttgatgagaagagaga |
34769218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University