View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4908_high_17 (Length: 416)

Name: NF4908_high_17
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4908_high_17
NF4908_high_17
[»] chr6 (2 HSPs)
chr6 (47-256)||(17365010-17365219)
chr6 (280-401)||(17365390-17365511)
[»] scaffold0142 (3 HSPs)
scaffold0142 (1-104)||(918-1021)
scaffold0142 (1-104)||(4452-4555)
scaffold0142 (332-401)||(12426-12495)
[»] chr5 (1 HSPs)
chr5 (118-279)||(23006776-23006937)
[»] chr1 (1 HSPs)
chr1 (86-280)||(20839256-20839450)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 47 - 256
Target Start/End: Original strand, 17365010 - 17365219
Alignment:
47 atttcgacaagatgacagaggctcaatatcaacaatgcattcactctcttgttggtcacatctcagacttcgtgcatgtctcttttcaagcttctgacga 146  Q
    |||| |||||||| |||||||||||||||||||||||||| || ||||||||||||||| || ||||||| |||| | ||||||||||||||||  || |    
17365010 atttggacaagataacagaggctcaatatcaacaatgcatgcagtctcttgttggtcacgtcccagactttgtgcctatctcttttcaagcttcccacaa 17365109  T
147 atgcactaaaagcttttctttgtggtggaaaaaatactacttcaccaaccttgttgatgaaccaacatttcgcactaaactgattagtgcttttccttct 246  Q
    ||||||  |||||||||||||||||||||| ||||||||||||| ||||||| ||||||| |||  |||||| || ||| |||| | ||| |||||||||    
17365110 atgcaccgaaagcttttctttgtggtggaataaatactacttcaacaaccttattgatgagccagtatttcggacaaaattgatcaatgcgtttccttct 17365209  T
247 ttgcagaaca 256  Q
    ||||||||||    
17365210 ttgcagaaca 17365219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 280 - 401
Target Start/End: Original strand, 17365390 - 17365511
Alignment:
280 tgaacaatgtactagccaaatacaaaatggctttaccattttattgggtaagattcccagcattacctagtgcagacttcaccttgtcttttgaacccaa 379  Q
    ||||||| | |||||||| |||||||||||||||| ||||||| |  ||||||||||||||||||||||||||||||||||| |||||||| ||||||||    
17365390 tgaacaacgcactagccagatacaaaatggctttagcattttactacgtaagattcccagcattacctagtgcagacttcactttgtctttcgaacccaa 17365489  T
380 ttacccttcttggttccatttt 401  Q
     |||||| ||||||||||||||    
17365490 ctaccctccttggttccatttt 17365511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142 (Bit Score: 56; Significance: 4e-23; HSPs: 3)
Name: scaffold0142
Description:

Target: scaffold0142; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 918 - 1021
Alignment:
1 catcctgcttccatagctatgatcctcaaatccatttatgaagatgatttcgacaagatgacagaggctcaatatcaacaatgcattcactctcttgttg 100  Q
    ||||| ||||| ||||| ||||| |||||  | |||||||| |||||||||||||| ||| ||||||||||||||||||||||| |||| ||||||||||    
918 catccagcttctatagccatgattctcaagacgatttatgatgatgatttcgacaaaatgtcagaggctcaatatcaacaatgccttcattctcttgttg 1017  T
101 gtca 104  Q
    ||||    
1018 gtca 1021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 4452 - 4555
Alignment:
1 catcctgcttccatagctatgatcctcaaatccatttatgaagatgatttcgacaagatgacagaggctcaatatcaacaatgcattcactctcttgttg 100  Q
    ||||| ||||| ||||| ||||| |||||  | |||||||| |||||||||||||| ||| ||||||||||||||||||||||| |||| ||||||||||    
4452 catccagcttctatagccatgattctcaagacgatttatgatgatgatttcgacaaaatgtcagaggctcaatatcaacaatgccttcattctcttgttg 4551  T
101 gtca 104  Q
    ||||    
4552 gtca 4555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0142; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 332 - 401
Target Start/End: Original strand, 12426 - 12495
Alignment:
332 attcccagcattacctagtgcagacttcaccttgtcttttgaacccaattacccttcttggttccatttt 401  Q
    |||||||||||| ||||||||||||||||| |||||||| ||||| |  || ||| ||||||| ||||||    
12426 attcccagcattgcctagtgcagacttcactttgtctttcgaaccaagctatcctccttggtttcatttt 12495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 118 - 279
Target Start/End: Original strand, 23006776 - 23006937
Alignment:
118 gtgcatgtctcttttcaagcttctgacgaatgcactaaaagcttttctttgtggtggaaaaaatactacttcaccaaccttgttgatgaaccaacatttc 217  Q
    |||| |||||||||||| |||||  | ||||||||  |||| || ||||||||| |||||||||||||| |  |||||||||| || |||||| ||||||    
23006776 gtgcctgtctcttttcaggcttcaaatgaatgcacagaaagtttctctttgtggaggaaaaaatactacctttccaaccttgtcgacgaaccagcatttc 23006875  T
218 gcactaaactgattagtgcttttccttctttgcagaacatatcgaagaaaactaaaggtatg 279  Q
    | || ||  |||| | |||||||||||||||||||| ||  |||||| ||| ||||||||||    
23006876 gtaccaacttgatcactgcttttccttctttgcagagcaagtcgaaggaaaataaaggtatg 23006937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 86 - 280
Target Start/End: Original strand, 20839256 - 20839450
Alignment:
86 ttcactctcttgttggtcacatctcagacttcgtgcatgtctcttttcaagcttctgacgaatgcactaaaagcttttctttgtggtggaaaaaatacta 185  Q
    |||| ||||||| |||||| ||  ||||||| |||| | |||||||| | |||||  | |||||||| ||||||||||||||||||| ||| ||||| ||    
20839256 ttcattctcttgctggtcatattccagactttgtgcctatctctttttatgcttcgcatgaatgcaccaaaagcttttctttgtggtagaacaaatatta 20839355  T
186 cttcaccaaccttgttgatgaaccaacatttcgcactaaactgattagtgcttttccttctttgcagaacatatcgaagaaaactaaaggtatgt 280  Q
    | |  |||||||||| || ||| || ||||||   | || ||||| |||| |||||||||||||||||  |   ||||||||| |||||||||||    
20839356 cctttccaaccttgtcgacgaaacatcatttcatgcaaacctgatcagtgattttccttctttgcagagtaagacgaagaaaaataaaggtatgt 20839450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University