View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_22 (Length: 394)
Name: NF4908_high_22
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 392
Target Start/End: Complemental strand, 17439153 - 17438761
Alignment:
| Q |
1 |
aatgtgttccctggaccgtttcagaaatggtactatgagcaaattcattagcaaatccaacaatttctgctgctataaggggtggacagaacttttgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17439153 |
aatgtgttccctggaccgtttcagaaatggtactatgagtaaattcatcagtaaatccagcaatttctgctgctattaggggtggacagaacttttgttt |
17439054 |
T |
 |
| Q |
101 |
attgagcacacaattgtttcttcccctccatattctccacaaggtaatgccaaacagttgagcagcataaatattgggactttttagccaagattgcaac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17439053 |
attgaacacacaattgtttcttcccctccatattctccacaaagtaatgccaaacagttgagcagcataaatattgggactttttagccaagattgcaac |
17438954 |
T |
 |
| Q |
201 |
caagataaaagattagcattatgtgggatatgtaggccaagaggagaagaaaaccagatctgctgcactaacgggcagagcataaagagatgctcgtgac |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17438953 |
caagataaaagattaacattatgtgggatatgtaggccaagaggagaagcaaaccaaatctgttgcactaacgggcagagcataaagagatgctcatgac |
17438854 |
T |
 |
| Q |
301 |
tctctttttcactgtaacaaagggggcagattgtgtccaaggaaatacctttcttttctagacgacctctggtagggagaat-aatttagcca |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
17438853 |
tctctttttcactgtaacaaagggggcagattgtgtccaaggaaatacctttcttttctagacggcctctggtagggagaatcaatttagcca |
17438761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University