View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_32 (Length: 338)
Name: NF4908_high_32
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 32323471 - 32323680
Alignment:
| Q |
19 |
caaaatacttttcaaagatgaaattgaatgtactccttcaaaaataatatattttacattatgttatttggtctttcaccagaatctccaatttcatagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32323471 |
caaaatacttttcaaagatgaaattgaatgtactccttgaaaaataatatattttacattatgttatttggtctttcaccaaaatctccaatttcatagc |
32323570 |
T |
|
| Q |
119 |
tataggataggattaacccttaggctagaggagacgtatatgcaaagcttttctcagagtggcaattctaacacctcaagtttgctggcaatgtttagtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32323571 |
tataggataggattaacccttaggctagaggagacgtatatgcaaagcttttctcagagtggcaattctaacacctcaagtttgctggcaatgtttagtt |
32323670 |
T |
|
| Q |
219 |
aagaatcttg |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
32323671 |
aagaatcttg |
32323680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 286 - 328
Target Start/End: Original strand, 32323738 - 32323780
Alignment:
| Q |
286 |
caagagttgttccacaaagatgtttgtgtctcccgtttttcat |
328 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32323738 |
caagatttgttccacaatgatgtttgtgtctcccgtttttcat |
32323780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University