View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_36 (Length: 325)
Name: NF4908_high_36
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 55 - 150
Target Start/End: Complemental strand, 32193015 - 32192920
Alignment:
| Q |
55 |
aaactgagtaatggacaatgttttgatgtggataattaaataaaataatgttaatgagaaatggtgattgcatcatcttttgtattcaaatattat |
150 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32193015 |
aaactgagtaatggagaatgttttgatgtggaaaattaaataaaataattttaatgagaaatggtgattgcatcatcttttgtattcaaatattat |
32192920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 3 - 53
Target Start/End: Complemental strand, 32194658 - 32194608
Alignment:
| Q |
3 |
tgaaattgaaattgatagatgcctacacttagatcgagagagagctcatta |
53 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32194658 |
tgaaattgaagttgatagatgcctacacttagatcacgagagagctcatta |
32194608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 3 - 34
Target Start/End: Complemental strand, 21549221 - 21549190
Alignment:
| Q |
3 |
tgaaattgaaattgatagatgcctacacttag |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21549221 |
tgaaattgaaattgatagatgcctacacttag |
21549190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 9 - 53
Target Start/End: Complemental strand, 20361433 - 20361389
Alignment:
| Q |
9 |
tgaaattgatagatgcctacacttagatcgagagagagctcatta |
53 |
Q |
| |
|
||||||||||||||||||||||||||| || | ||||||||||| |
|
|
| T |
20361433 |
tgaaattgatagatgcctacacttagaccgctacagagctcatta |
20361389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University