View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4908_high_43 (Length: 299)
Name: NF4908_high_43
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4908_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 295
Target Start/End: Original strand, 16283290 - 16283565
Alignment:
| Q |
20 |
gttttattttcgttgagaatttcaaaattgcgaggttagtttcagtttacgttttgctttgccgacgaacaattgatgcgtttcgatcttcatgtatact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16283290 |
gttttattttcgttgagaatttcaaaattgcgaggttagtttcagtttacgttttgctttgccgacgaacaattgatgcgtttcgatcttcatgtatatt |
16283389 |
T |
|
| Q |
120 |
gtgttgattttcatttttcactgtatgcattttactctgaaaattgtgattctatgtgctcgttgcggcaagaagcagattttgtaactctgatgaaatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16283390 |
gtgttgattttcatttttcactgtatgcattttactctgaaaattgtgattctatgtacctgttgcggcgagaagcagattttgtaactctgatgaaatt |
16283489 |
T |
|
| Q |
220 |
tttctgtttttatctcattggtcctagtgtagttgtttcgattttcgttccacactgttagcatttcatctcactc |
295 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16283490 |
tttctgtttttatctcatttgtcctagtgtagttgtttcgattttcgttccacactgttagcatttcatttcactc |
16283565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 16282020 - 16282058
Alignment:
| Q |
146 |
gcattttactctgaaaattgtgattctatgtgctcgttg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16282020 |
gcattttactctgaaaattgtgattctatgtgctagttg |
16282058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 147 - 182
Target Start/End: Original strand, 16282879 - 16282914
Alignment:
| Q |
147 |
cattttactctgaaaattgtgattctatgtgctcgt |
182 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16282879 |
cattttactctgaaaattgagattctatgtgctcgt |
16282914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 65
Target Start/End: Original strand, 16283118 - 16283148
Alignment:
| Q |
35 |
agaatttcaaaattgcgaggttagtttcagt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
16283118 |
agaatttcaaaattgcgaggttagtttcagt |
16283148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 147 - 179
Target Start/End: Original strand, 16281426 - 16281458
Alignment:
| Q |
147 |
cattttactctgaaaattgtgattctatgtgct |
179 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
16281426 |
cattttactctgacaattgtgattctatgtgct |
16281458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 109
Target Start/End: Original strand, 16281679 - 16281754
Alignment:
| Q |
36 |
gaatttcaaaattgcgaggttagtt--tcagtttacgttttgctttgccgacgaacaattgatgcgtttcgatctt |
109 |
Q |
| |
|
||||||||||||||||||||||||| | |||| ||||||||||| || | ||| | ||||||||||| |||||| |
|
|
| T |
16281679 |
gaatttcaaaattgcgaggttagtttatgagttcacgttttgcttctccaatgaagagttgatgcgttttgatctt |
16281754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University