View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4908_high_52 (Length: 267)

Name: NF4908_high_52
Description: NF4908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4908_high_52
NF4908_high_52
[»] chr8 (2 HSPs)
chr8 (112-257)||(9179729-9179874)
chr8 (19-53)||(9179933-9179967)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 112 - 257
Target Start/End: Complemental strand, 9179874 - 9179729
Alignment:
112 gtactgttcaccgtacttatacgataaacagtgcacaaatgtcgtattgttgacaattattatgttcaaattacttgcaaacaagaattttggaacggcc 211  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
9179874 gtactgttcaccgtacttatacgataaacagtgcacaaacgtcgtattgttgtcaattattatgttcaaattacttgcaaacaagaattttggaacggcc 9179775  T
212 tattgcttatgataggcaacttttattttagattaggtgacctatg 257  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
9179774 tattgcttatgataggcaacttttattttagattaggtgacctatg 9179729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 9179967 - 9179933
Alignment:
19 gatttaacttaaattttgtgttacaaaatcaccgt 53  Q
    |||||||||||||||||||||||||||||||||||    
9179967 gatttaacttaaattttgtgttacaaaatcaccgt 9179933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University